plenti lifeact irfp670 blastr (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
plenti lifeact irfp670 blastr
Plenti Lifeact Irfp670 Blastr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plenti+lifeact+irfp670+blastr/pLenti+Lifeact-iRFP670+BlastR+(Plasmid+%2384385)/bio_rxiv__2025__11__26__690550-174-40-49
Average 93 stars, based on 15 article reviews
Plenti Lifeact Irfp670 Blastr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plenti+lifeact+irfp670+blastr/pLenti+Lifeact-iRFP670+BlastR+(Plasmid+%2384385)/bio_rxiv__2025__11__26__690550-174-40-49
Average 93 stars, based on 15 article reviews
plenti lifeact irfp670 blastr - by Bioz Stars,
2026-11
93/100 stars
Images
Related Articles
other:Article Title: EVL and MIM/MTSS1 regulate actin cytoskeletal remodeling to promote dendritic filopodia in neurons Article Snippet: Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). Transfection:Article Title: On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members Article Snippet: Transfected construct (synthetic) , PAtetON_L321_C1673=_ CSII-CAG-MCS-IRES-Snap-Bsd , DOI: 10.1016/j.celrep.2018.09.026 , , Lentiviral construct for photoactivatable TetON system. .. Transfected construct (synthetic) , Construct:Article Title: On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members Article Snippet: Transfected construct (synthetic) , PAtetON_L321_C1673=_ CSII-CAG-MCS-IRES-Snap-Bsd , DOI: 10.1016/j.celrep.2018.09.026 , , Lentiviral construct for photoactivatable TetON system. .. Transfected construct (synthetic) , Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, Expressing:Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, Generated:Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, Article Title: Bioenergetic responses to β-adrenergic stimulation in beige adipocyte depend on actomyosin driven forces Article Snippet: .. Myh9 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACCCTTTGAGAATCTGATACTAGT GAAGCCACAGATGTAGTATCAGATTCTCAAAGGGTAGTGCCTACTGCCTCGG-3′) Bottom Strand 5’AATTCCGAGGCAGTAGGCACTACCCTTTGAGAATCTGATACTACATCTGTGGCTTCA CTAGTATCAGATTCTCAAAGGGTAGCGCTCACTGTCAACAGCAATATACCTTC-3’) Myh10 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCTCCACAAGACATGCGTATTTAGT GAAGCCACAGATGTAAATACGCATGTCTTGTGGAGGGTGCCTACTGCCTCGG-3’) Bottom Strand 5’AATTCCGAGGCAGTAGGCACCCTCCACAAGACATGCGTATTTACATCTGTGGCTTCA CTAAATACGCATGTCTTGTGGAGGGCGCTCACTGTCAACAGCAATATACCTTC-3’) PLIN5 overexpression (OE) cell lines were generated using Genscript GenEZTM ORF clones with pGenLenti backbone (Plin5_OMu18852C_pGenLenti). Subcloning:Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, Plasmid Preparation:Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, Article Title: Bioenergetic responses to β-adrenergic stimulation in beige adipocyte depend on actomyosin driven forces Article Snippet: .. Myh9 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACCCTTTGAGAATCTGATACTAGT GAAGCCACAGATGTAGTATCAGATTCTCAAAGGGTAGTGCCTACTGCCTCGG-3′) Bottom Strand 5’AATTCCGAGGCAGTAGGCACTACCCTTTGAGAATCTGATACTACATCTGTGGCTTCA CTAGTATCAGATTCTCAAAGGGTAGCGCTCACTGTCAACAGCAATATACCTTC-3’) Myh10 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCTCCACAAGACATGCGTATTTAGT GAAGCCACAGATGTAAATACGCATGTCTTGTGGAGGGTGCCTACTGCCTCGG-3’) Bottom Strand 5’AATTCCGAGGCAGTAGGCACCCTCCACAAGACATGCGTATTTACATCTGTGGCTTCA CTAAATACGCATGTCTTGTGGAGGGCGCTCACTGTCAACAGCAATATACCTTC-3’) PLIN5 overexpression (OE) cell lines were generated using Genscript GenEZTM ORF clones with pGenLenti backbone (Plin5_OMu18852C_pGenLenti). Article Title: On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members Article Snippet: CRISPR technology has made generation of gene knockouts widely achievable in cells.. However, once inactivated, their reactivation remains difficult, especially in diploid cells.. Here, we present DExCon (Doxycyclinemediated endogenous gene Expression Control), DExogron (DExCon combined with auxinmediated targeted protein degradation), and LUXon (light responsive DExCon) approaches which combine onestep CRISPRCas9mediated targeted knockin of fluorescent proteins with an advanced Tetinducible TRE3GS promoter. .. CRISPR technology has made generation of gene knockouts widely Article Title: DExCon, DExogron, LUXon: on-demand expression control of endogenous genes reveals differential dynamics of Rab11 family members Article Snippet: TRE3GS was removed by Cla/EcorI cleavage from 3rd generation tet inducible vector pCDH-TRE3GS-EF1a-tagBFP-T2A-TetOn3G (gift from Andrew Gilmore lab) to generate DExCon modules, and the plasmid modified by Gibson assembly to generate pCDH-EF1a-HygroR-T2A-TetOn3G with Hygromycin resistance (for DExogron). .. Other plasmids used (for details see excel file S1): Article Title: An extended and apical supracellular actin network interconnects squamous carcinoma cells Article Snippet: Lentiviral packaging plasmid psPAX2 (Addgene; plasmid # 12260) and envelope plasmid pCMV-VSV-G (Addgene; plasmid # 8454) were gifts from Didier Trono and Bob Weinberg, respectively. .. To produce lentiviruses, these were used in conjunction with different transfer plasmids presented here after. pLenti LifeAct-EGFP BlastR (Addgene; plasmid # 84383) and Article Title: On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members Article Snippet: TRE3GS was removed by Cla/EcorI cleavage from third-generation tet inducible vector pCDH-TRE3GS-EF1a-tagBFP-T2A-TetOn3G (gift from Andrew Gilmore lab) to generate DExCon modules, and the plasmid modified by Gibson assembly to generate pCDH-EF1a-HygroR-T2A-TetOn3G with hygromycin resistance (for DExogron). .. Other plasmids used (for details see excel file S1): Modification:Article Title: Systems and methods for determining a treatment course of action Article Snippet: .. Lentiviral expression constructs pLenti EF1a-eGFP-EVL, pLenti EF1a-eGFP, shRNA:Article Title: Bioenergetic responses to β-adrenergic stimulation in beige adipocyte depend on actomyosin driven forces Article Snippet: .. Myh9 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACCCTTTGAGAATCTGATACTAGT GAAGCCACAGATGTAGTATCAGATTCTCAAAGGGTAGTGCCTACTGCCTCGG-3′) Bottom Strand 5’AATTCCGAGGCAGTAGGCACTACCCTTTGAGAATCTGATACTACATCTGTGGCTTCA CTAGTATCAGATTCTCAAAGGGTAGCGCTCACTGTCAACAGCAATATACCTTC-3’) Myh10 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCTCCACAAGACATGCGTATTTAGT GAAGCCACAGATGTAAATACGCATGTCTTGTGGAGGGTGCCTACTGCCTCGG-3’) Bottom Strand 5’AATTCCGAGGCAGTAGGCACCCTCCACAAGACATGCGTATTTACATCTGTGGCTTCA CTAAATACGCATGTCTTGTGGAGGGCGCTCACTGTCAACAGCAATATACCTTC-3’) PLIN5 overexpression (OE) cell lines were generated using Genscript GenEZTM ORF clones with pGenLenti backbone (Plin5_OMu18852C_pGenLenti). Over Expression:Article Title: Bioenergetic responses to β-adrenergic stimulation in beige adipocyte depend on actomyosin driven forces Article Snippet: .. Myh9 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACCCTTTGAGAATCTGATACTAGT GAAGCCACAGATGTAGTATCAGATTCTCAAAGGGTAGTGCCTACTGCCTCGG-3′) Bottom Strand 5’AATTCCGAGGCAGTAGGCACTACCCTTTGAGAATCTGATACTACATCTGTGGCTTCA CTAGTATCAGATTCTCAAAGGGTAGCGCTCACTGTCAACAGCAATATACCTTC-3’) Myh10 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCTCCACAAGACATGCGTATTTAGT GAAGCCACAGATGTAAATACGCATGTCTTGTGGAGGGTGCCTACTGCCTCGG-3’) Bottom Strand 5’AATTCCGAGGCAGTAGGCACCCTCCACAAGACATGCGTATTTACATCTGTGGCTTCA CTAAATACGCATGTCTTGTGGAGGGCGCTCACTGTCAACAGCAATATACCTTC-3’) PLIN5 overexpression (OE) cell lines were generated using Genscript GenEZTM ORF clones with pGenLenti backbone (Plin5_OMu18852C_pGenLenti). Clone Assay:Article Title: Bioenergetic responses to β-adrenergic stimulation in beige adipocyte depend on actomyosin driven forces Article Snippet: .. Myh9 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACCCTTTGAGAATCTGATACTAGT GAAGCCACAGATGTAGTATCAGATTCTCAAAGGGTAGTGCCTACTGCCTCGG-3′) Bottom Strand 5’AATTCCGAGGCAGTAGGCACTACCCTTTGAGAATCTGATACTACATCTGTGGCTTCA CTAGTATCAGATTCTCAAAGGGTAGCGCTCACTGTCAACAGCAATATACCTTC-3’) Myh10 shRNA oligos: Top Strand 5′- TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCTCCACAAGACATGCGTATTTAGT GAAGCCACAGATGTAAATACGCATGTCTTGTGGAGGGTGCCTACTGCCTCGG-3’) Bottom Strand 5’AATTCCGAGGCAGTAGGCACCCTCCACAAGACATGCGTATTTACATCTGTGGCTTCA CTAAATACGCATGTCTTGTGGAGGGCGCTCACTGTCAACAGCAATATACCTTC-3’) PLIN5 overexpression (OE) cell lines were generated using Genscript GenEZTM ORF clones with pGenLenti backbone (Plin5_OMu18852C_pGenLenti). |